Comparative analysis of glucoprotein profies of SH-SY5Y cells stably expressing the wild type fat mass and obesity associated proteins
- Home
- Journals
- 2017
- Comparative analysis of glucoprotein profies of SH-SY5Y cells stably expressing the wild type fat ma...
ABSTRACT
ABSTRACT • Background and Aims: Genome wide association studies have shown that fat mass and obesity associated protein, initially associated with obesity, is associated with metabolic diseases, cancer, brain diseases and the cardiovascular system. Fat mass and obesity associated protein is a nuclear protease belonging to the oxidative DNA/RNA demethylase superfamily associated with AlkB-related non-Fe (II)/2-oxoglutarate. In vitro, in the presence of Fe2+ and 2-oxoglutarate, fat mass and obesity associated protein has been shown to be catalyze demethylation of 3-meT from a single-stranded DNA, 3-meU from a single-stranded RNA and 6-meA from both DNA and RNA. These in vitro studies suggest that the physiological role of fat mass and obesity associated protein may be related to nucleic acid repair or modifiation. However, the exact physiological function of this protein is still unknown. In this study, changes in the level of glucoproteomes after exogenous expression of the wild type wild type fat mass and obesity associated protein were studied. Materials and Methods: Protein extracts prepared from SH-SY5Y cells exogenously expressing and non-expressing the wild type fat mass and obesity associated protein were subjected to 2D gel electrophoresis. Gels were fist stained with a glycosylated proteinspecifi dye, ProQ-Emerald-300, and then with a total protein stain SYPRO Ruby. Results: After comparative protein spots analysis, there were no changes in the patterns of glycoproteins expressed by the wild type fat mass and obesity associated protein harboring cells. Conclusion: The expression of wild type fat mass and obesity associated protein was not a signifiant effect on the expression patterns of glycoproteins in SH-SY5Y cells
INTRODUCTION
Fat mass and obesity-associated (FTO) protein is a nuclear protein of the AlkB related non-heme Fe (II)/2-OG-dependent oxidative DNA/RNA demethylases superfamily but the exact physiological function of this gene is not known. Recombinant FTO protein was first discovered to catalyze demethylation of 3-methylthymine in single-stranded DNA, and 3-methyluridine in single-stranded RNA, with low efficiency (1,2). The nucleoside N6-methyladenosine, an abundant modification in RNA, was then found to be a major substrate of FTO (3,4). The internal 6-methyladenin (6mA) modification in mRNA, which it also exists in other RNA species such as tRNA (5) and rRNA (6), was demonstrated to be a dynamic mark (3,4,7,8). These in vitro studies suggest that the physiological role of FTO may be related to nucleic acid repair or modification (9,10). However, the role of FTO may not be limited to DNA repair or modification. Initial immunofluorescense studies appeared to show that FTO was localized to the nucleus with no signal detected in the cytoplasm (1,11). Subsequently, FTO was shown to co-localize with nuclear speckles, supporting that 6mA in nuclear RNA could be a relevant substrate for FTO (3). Afterwards, Gulati et al (2013) was able to detect a substantial proportion of FTO residing in the cytoplasmic fraction (12). In a later study, FTO was found to be present in both the nucleus and cytoplasm, with a mobile fraction that shuttles between both cellular compartments, possibly by interaction with exportin 2 (XPO2) (13). The genome-wide association studies revealed the relationship between SNPs (single nucleotide polymorphisms) of the first intron of the FTO (fat mass and obesity-associated) gene and obesity (14-16). The variant most strongly associated with obesity is found in intron 1 of the FTO gene. In contrast, loss-of-function mutation (R316Q) in the FTO gene, disruption of FTO’s demethylase activity, is responsible for a recessive lethal syndrome that includes postnatal growth retardation, microcephaly, psychomotor delay, brain deficits and cardiac defects (17). Caglayan et al (2016) described a patient born of consanguineous union who presented with microcephaly, developmental delay, behavioral abnormalities, dysmorphic facial features, hypotonia, and other various phenotypic abnormalities that carrying a novel homoygous missense mutation in FTO (His271Pro) and concomitant nonsense mutation in cholesterol ester transfer protein (CETP) that is resulting in an early protein truncation. (18). Initial studies on FTO have focused on the relationship between diabetes, obesity and metabolism (19). Studies in mice and humans have shown that the single nucleotide polymorphisms (SNPs) of FTO gene have been shown to be associated with metabolic diseases (obesity, type 2 diabetes and polycystic ovary), cancers (melanoma, breast, endometrial, pancreatic, prostate, colorectal, lung and kidney),brain diseases (brain volume deficiency and Alzheimer’s disease) and the cardiovascular system (20). Although the involvement of FTO in various diseases have been firmly established there is still a huge amount of space to improve our understanding of molecular functions of FTO in cells. The information regarding the physiological function of FTO mainly comes from activity studies in which demethylase activity of FTO was demonstrated. However those findings do not shed onto the possible effects of FTO’s function on cellular interactome, proteome and transcriptome. One of the missing points to comprehensively study is the effect of FTO’s action on post-translational modifications (PTMs). In this communication, we focused our attention to protein glycosylation. We asked the question of whether expressed FTO would affect protein glycosylation in neuroblastoma cells. To answer this question, we used a 2D-based glycoproetome analysis approach. Our findings indicated that FTO did not have a pronounced effect on glycoproteome.
MATERIALS
Isolation of RNA from blood and cDNA
synthesis Total RNA was isolated from fresh blood samples according to the instructions provided by the manufacturer (Qiagen, USA) (Code of Ethics Approval: KOU KAEK 2013/25). The quality of each RNA sample was assessed using formaldehyde-agarose gels. The cDNA synthesis reaction was carried out immediately after RNA isolation and the reaction mix consisted of 5 μg of RNA, 1 mM of dNTPs, 0.2 μg of random hexamer primers, 20 units of riboblock inhibitor and 200 units of M-MuLV RT enzyme (Fermentas, USA). An initial 1 min denaturation at 90°C was applied to the RNA, primer, and dNTP mixture, and then the temperature was lowered to 42°C before the addition of M-MuLV RT enzyme plus riboblock inhibitor. The reaction was then allowed to run for 3 h at 42°C.
Amplifiation of wild type FTO gene by polymerase chain reaction
For the second strand synthesis, polymerase chain reaction (PCR) was performed with a long PCR enzyme mix (Fermentas, USA). The sense and antisense primers With cutting sites at the ends were 5′- AACTTAAGCTTATGAAGCGCACCCCCGACTG and 5′- CTCGAGCTCGAGCTAGGGTTTTGCTTCCAGAAGCTG, respectively. A 25 μL PCR reaction mixture consisted of 1× long PCR buffer, 0.2 mM of each dNTPs, 0.5 μM of each primer, 1.25 mM MgCl2, 1.5 units of long PCR enzyme mix, 2 μL of first strand cDNA reaction (ThermoScientific, USA). An initial 5 min denaturation at 94°C was followed by 35 cycles of 30 s denaturation at 94°C, 1 min annealing at 57°C and 60 s elongation at 72°C. PCR reactions were ended with 10 min final elongation at 72°C (TC-3000X Thermal Cycler (Techne, ABD). PCR products were analyzed by agarose gel electrophoresis, cleaned with a PCR purification kit (Qiagen, USA) and sequenced (Iontek Inc., Istanbul, Turkey).
Creation of plasmid constructs
The PCR product was digested with HindIII and XhoI and ligated into the vectors using routine molecular biology techniques (21). pCDNA4/TO (Invitrogen, USA) was used for stable tetracyclineinducible FTO expression in SH-SY5Y (Invitrogen, USA). Full-length cDNA of human wild type (WT) FTO was cloned into pcDNA4/TO (Life Tech, USA) after reverse transcription. The constructs were sequenced and in-frame FTO sequences were verified (Iontek, Istanbul).
Cell culture and creation of stable cell lines expressing the WT FTO protein
SH-SY5Y cells were grown in Eagle’s minimum essential medium (EMEM) supplemented with 10% (Vol/Vol) tetracycline-reduced fetal bovine serum, 100 U/ml penicillin-streptomycin and 2 mM L-glutamine at 37°C in a humidified 5% CO2 atmosphere. The Tet-R + stabile SH-SY5Y cell line was obtained in our previous study (22) and used in subsequent experiments. Transfection and stable selection of SH-SY5Y cells were performed according to the instructions recommendations (Invitrogen, USA). SH-SY5Y-TetR+ cells were transfected with pcDNA4/TO harboring the WT FTO to create an inducible stable cell line expressing WT FTO protein using the electrotransfection method. Transfected cells were then subjected to a selection in the medium containing 50 μg/ml zeocin. Individual clones were isolated, grown and examined for FTO protein expression by western blotting with an anti-FTO antibody (Santa Cruz, USA).
Preparation of protein extracts
The cells were washed three times with ice-cold phosphate buffer saline (PBS) and homogenized in DIGE lysis buffer (30 mM tris, 7 M urea, 2 M thiourea, 5 mM magnesium acetate, 4% (w/v) CHAPS pH 8.5), by using 0.1 mm glass beads in a mechanical disruption device (Bullet Blender; Next Advance, USA). Homogenates were centrifuged at 15.000×g for 30 min at 4°C to remove cell debris. Protein concentrations were determined by modified Bradford assay (23) and protein extracts were aliquoted, snap-frozen in liquid nitrogen and stored at −80°C.
Western blot analysis
Western blot (WB) analysis was performed using anti-FTO [Clone C-3 (sc-271713), Santa Cruz, USA], and anti-Beta actin (Santa Cruz, USA; ACTBD, sc-81178) antibodies as described by Guzel et al (10).
2DE-based glycoproteomics experiments
In brief, approximately 250 μg of protein was loaded onto an immobilized pH gradient strips (11 cm, pH 3–10, nonlinear) (BioRad, USA) via passive rehydration at 22°C for 16 hr. The strip was run through a stepwise incremental voltage program [250V for 20 min (linear), 10.000 V for 2 hr (linear) and 30.000 V/hr (rapid)] by using Protean IEF system (BioRad,USA). The strip was then subjected to a two-step equilibration in buffers containing 6 M urea, 2% sodium dodecyl sulphate (SDS), 0.375 M Tris. Cl pH 8.8, 20% glycerol and 2% dithiothreitol (DTT) for the first step and the same buffer without DTT but with iodoacetamide (2.5%) for the second step. The strip was then subjected to second dimension separation using SDS-PAGE (12%). CandyCane™ glycoprotein (Invitrogen, ABD) was used as a molecular weight standard in glycoproteomics studies.
Staining of glycoproteins with Pro-Q Emerald-300
The WT-FTO-expressing SH-SY5Y cells were under culture conditions. When cell density reached about 75%, tetracycline (Tet, 1 μg/ml) was added to the cell culture for expression of WT FTO, induction was performed for 24 hours. Before harvesting the cells, a three-time wash was performed to remove media components. The glycosylated proteins were stained with according to the Pro-Q Emerald 300 following the manufacturer’s recommendation. In brief, gels were fixed 60 minutes in 50% (v/v) methanol, 5% (v/v) acid. Following wash steps with two changes of 3% acetic acid for 15 min, gels were oxidized with oxidizing reagent (3% acetic acid, 2.5 g periodic acid in 250 ml) for 30 min. Following wash steps with three changes of 3% acetic acid for 15 min, gels were incubated in Pro-Q Emerald 300 fluorescence dye (Invitrogen, USA) for 120 minute in dark. De-staining was achieved with two successive washes using 3% (v/v) acetic acid for 15 min. Images were obtained after washing. The gels were visualized with VersaDoc4000MP (Bio-Rad, USA). Then the same gels were stained with Sypro Ruby (BioRad, USA) for the purpose of displaying all the proteins. Gels were fixed at least 30 minutes in 50% (v/v) methanol, 7% (v/v) trichloroacetic. Following wash steps with four changes of distilled water for 10 min, gels were incubated overnight in SYPRO Ruby fluorescence dye in dark. De-staining was achieved with four successive washes using 10% (v/v) methanol and 7% acetic acid. Images were obtained after washing.
Image analysis
The images were analyzed with PD Quest Advanced software with VersaDoc4000 MP (BioRad, US). For automated spot detection, parameters used were sensitivity (13.8), spot size scale (3), and minimum peak intensity (258). PD Quest Advance 2D-analysis software (BioRad, USA) was used for comparative analysis of protein spots. The outside edges of the image were cropped using the automated crop tool of PD Quest Advance Software. Stain speckles were filtered and the standardized areas of interest from all gels were matched and warped, and the quantity of each spot was normalized using the total valid spot intensity. Total spot numbers and volumes within the normalized area were determined by the automated analyses. Quantity of each spot was normalized by linear regression model. A manual editing tool was used to inspect the determined protein spots detected by the software.
RESULTS
FTO PCR and cloning of the wild type FTO PCR product
Total RNA isolation from leukocytes from a healthy individual was performed with commercially available RNA isolation kit (Qiagen, USA) (Code of Ethics Approval: KOU KAEK 2013/25). PCR products were analyzed by agarose gel electrophoresis (Figure 1). The wild-type FTO PCR product was cloned into the pcDNA4/TO expression vector. To verify the clone, the insert was excised using double digest with HindIII and XhoI and the resulting products were analysed using 1% etidium bromide agarose gel (Figure 2). The clone was labeled as pcDNA4/TO-WT-FTO and was sequenced to assess its integrity (Iontek, Istanbul). Prior to transfection into SH-SY5Y cells, endofree plasmid isolation was performed as suggested by the kit (Qiagen). In silico map for pcDNA4/TO-WT-FTO clone was shown in Figure 3.
Establishment of stable cell lines capable of expressing the wild type FTO
SH-SY5Y cell lines expressing the WT FTO under the control of Tet induction were created using pcDNA4/TO-WT-FTO clone (Figure 4). Several of these cell lines were screened for FTO expression using western blotting (Figure 5). Three of the screened colonies were selected based on their tight controlled expressing of the FTO protein and one of those colonies (colony #5) was used in subsequent studies. To compare FTO levels before and after induction, we performed WB analysis in which 20 μg/lane of FTO negative and positive protein extracts were used. Three different exposure times were used (2 min, 15 min and overexposed) to detect any endogenous FTO protein expression. While there was a high level of exogenous FTO expression in induced cells within a short period of exposure time, a relatively weak band belonging to endogenous FTO protein was observed after a prolonged time of exposure (Figure 6). The expression profiles at the basal level observed in in vitro expression studies are not problematic in interpreting the obtained data. In similar studies in the literature, basal level expression was overlooked (22). When concentrations of cell cultures reached 75%, addition of 1 μg/ml tetracycline was performed in order to synthesize WT FTO protein in SH-SY5YTetR+ -WT-FTO (clone #5) cells. After 24 hours of incubation, the tetracycline-induced and uninduced cells were washed 3 times with cold PBS. For the glycoproteomics study, protein extracts were made using DIGE buffer, 0.1 mm steel beads. Routine 2DE protocol was followed for differences in the first and second dimensions. To display only the glycosylated proteins, the gels were stained according to the Pro-Q Emerald 300 process the manufacturer’s recommendation. Then the same gels were stained with Sypro Ruby for the purpose of displaying all the proteins. The images were analyzed with PD Quest Advanced software with VersaDoc4000 MP (BioRad, US). For automated spot detection, parameters used were sensitivity (13.8), spot size scale (3), and minimum peak intensity (258). A comparative analysis of the gels after staining with Pro-Q Emerald 300 was performed for the samples with and without wild-type FTO expressed. 33 glycosylated protein spots were matched in the ind and unind gels. As a result of the analysis, there was no change in the regulation of these proteins. More than 500 protein spots were analyzed as a result of SYPRO staining of the same subjects. Analysis by the PDQuest Advance program revealed no regulation of phosphoprotein levels in SH-SY5Y cells, with or without the WT FTO proteins (Figure 7).
DISCUSSION
In the present study, we investigated the possible effects of exogenously expressed wild type FTO on the glycoproteom of SH-SY5Y cells, a well-known human brain-derived neuroblastoma cell line. This cell line is often used to study the changes in neuronal system as a model. FTO plays a particularly important role in adipocytes and in hypothalamic neurons (24). FTO is highly expressed in the hypothalamus (25), an area of the brain strongly linked to eating behavior. To mimic the role of FTO on neuronal system, we also used this cell line. The effect of FTO may be elucidated in several ways. For instance, FTO may behave as a hub to control or dictate changes occurring at the genomic level. Studies already provided some evidence for this type of role FTO harbors. In addition, a transcriptomic aspect of FTO may provide a second control mechanism for cells to control their FTO associated pathways. Indeed, a BioGrid search to elucidate the interaction partners of FTO easily retrieved twenty eight interactors (Figure 8). (https://thebiogrid. org/122520/summary/homo-sapiens/fto.html). A recent study established a link between FTO and HNRNPK, a seemingly to unrelated proteins, via ubiquitin C (10). The authors of that study commented on their findings by predicting that FTO may dictate the metabolic changes occurring in cells by partnering with other multifunctional proteins. The observation of the involvement of ubiquitin C may well be presented as a putative evidence for such interaction networks. A BioGrid search with ubiqutin C indicated the presence of 1579 unique interactions creating various possible metabolic roads to connect distantly related proteins. FTO itself is post-translationally modified (26). Therefore, a prediction of its involvement in various post translations modifications (PTMs) may be logical. However, the involvement of FTO in PTM associated networks has not been studied in detail. Therefore in this study we wished to scrutinize the changes on glycosylation patterns upon FTO expression. Detailed search for the proteins retrieved by BioGrid search predicted that SDC1, OR5F1, FIBB, MPZL1, CTSA (PPGB) proteins were glycosylated (Supplementary Material). (https://thebiogrid.org/122520/summary/homo-sapiens/fto.html).However, in our hands, SH-SY5Y cells expressing FTO protein did not display any significant change in their glycosylation pattern. However, this does not necessarily mean that FTO is certainly not involved in changes occurring in glycosylation of various proteins. We are aware that the experimental approaches sometimes are not able to reflect the complexity of cellular changes. The 2D-based glycoproteomic approach, although useful did not provide us with valuable information to dwell on. Therefore it is our conclusion to suggest that alternative approaches besides 2D-based glycoproteomics should be utilized to elucidate the effect of FTO on glycoproteomics.
Conflcts of Interest
The authors declare that there are no conflicts of interest regarding the publication of this paper. Acknowledgments: This work was supported by The Scientific & Technological Research Council of Turkey (TUBITAK) with Project number: SBAG-(113S965).
REFERENCES
1. Gerken T, Girard CA, Tung YC et al. The obesity-associated FTO gene encodes a 2-oxoglutarate-dependent nucleic acid demethylase. Science 2007; 318(5855):1469-1472.
2. Jia G, Yang CG, Yang S et al. Oxidative demethylation of 3-methylthymine and 3-methyluracil in single-stranded DNA and RNA by mouse and human FTO. FEBS Lett. 2008; 582:3313–3319 3
. Jia G, Fu Y, Zhao X et al. N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat Chem Biol 2011; 7(12):885-887.
4. Meyer KD, Saletore Y, Zumbo P et al. Comprehensive analysis of mRNA methylation reveals enrichment in 3’ UTRs and near stop codons. Cell 2012; 149(7):1635-1646.
5. Saneyoshi M, Harada F, Nishimura S. Isolation and characterization of N6-methyladenosine from Escherichia coli valine transfer RNA. Biochim Biophys Acta. 1969; 190(2):264-273.
6. Iwanami Y, Brown GM. Methylated bases of ribosomal ribonucleic acid from HeLa cells. Arch Biochem Biophys. 1968; 126(1):8-15.
7. Dominissini D, Moshitch-Moshkovitz S, Schwartz S et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 2012; 485(7397):201-206.
8. Meyer KD, Jaffrey SR. The dynamic epitranscriptome: N6-methyladenosine and gene expression control. Nat Rev Mol Cell Biol. 2014; 15(5):313-326.
9. Yi C, He C. DNA repair by reversal of DNA damage. Cold Spring Harb Perspect Biol. 2013; 5(1):a012575. doi: 10.1101/cshperspect.a012575.
10. Guzel N, Kasap M, Kanli A et al. Exogenous Expressions of FTO Wild-Type and R316Q Mutant Proteins Caused an Increase in HNRPK Levels in 3T3-L1 Cells as Demonstrated by DIGE Analysis. Biomed Res Int. 2017; doi: 10.1155/2017/8216180. Epub 2017 May -
11. Meyre D, Proulx K, Kawagoe-Takaki H et al. Prevalence of lossof-function FTO mutations in lean and obese individuals. Diabetes 2010; 59:311–318.
12. Gulati P, Cheung MK, Antrobus R et al. Role for the obesity-related FTO gene in the cellular sensing of amino acids. Proc. Natl. Acad. Sci. U. S. A. 2013; 110:2557–2562.
13. Gulati P, Avezov E, Ma M et al. Fat mass and obesity-related (FTO) shuttles between the nucleus and cytoplasm. Biosci Rep. 2014; Oct 22;34(5). pii: e00144. doi: 10.1042/ BSR20140111).
14. Dina C, Meyre D, Gallina S et al. Variation in FTO contributes to childhood obesity and severe adult obesity. Nat Genet. 2007; 39(6):724-726.
15. Frayling TM, Timpson NJ, Weedon MN et al. A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. Science 2007; 316(5826):889-894.
16. Scuteri A, Sanna S, Chen WM et al. Genome-wide association scan shows genetic variants in the FTO gene are associated with obesity-related traits. PLoS Genet 2007; 3(7):e115.
17. Boissel S, Reish O, Proulx K et al. Loss-of-function mutation in the dioxygenase-encoding FTO gene causes severe growth retardation and multiple malformations”. Am J Hum Genet 2009; 85(1):106-111.
18. Caglayan AO, Tuysuz B, Coskun S et al. A patient with a novel homozygous missense mutation in FTO and concomitant nonsense mutation in CETP. J Hum Genet. 2016; 61(5):395-403
19. Larder R, Cheung MK, Tung YC et al. where to go with FTO? Trends Endocrinol Metab 2011; 22(2):53-59.
20. Zhao X, Yang Y, Sun BF et al. FTO and Obesity: Mechanisms of Association. Curr Diab Rep 2014; 14:486.
21. Sambrook H, Russell DW. Molecular Cloning Laboratory Manual. Cold Spring Harbor Laboratory Press 2001 Creation of Plasmid Constructs
22. Ozgul A, Kasap M, Akpinar G et al. Linking a compound-heterozygous Parkin mutant (Q311R and A371T) to Parkinson’s disease by using proteomic and molecular approaches. Neurochemistry International 2015; 85-86: 1–13
23. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976; 72:248–254
24. Pitman RT, Fong JT, Billman P, Puri N. Knockdown of the fat mass and obesity gene disrupts cellular energy balance in a cell-type specifi manner. PLoS One. 2012; 7(6):e38444. doi: 10.1371/journal.pone.0038444. Epub 2012 Jun 4.
25. Fredriksson R, Hägglund M, Olszewski PK et al. The obesity gene, FTO, is of ancient origin, up-regulated during food deprivation and expressed in neurons of feeding-related nuclei of the brain.Endocrinology 2008;149(5):2062-2071.
26. Bonacci T, Audebert S, Camoin L et al. Identifiation of new mechanisms of cellular response to chemotherapy by tracking changes in post-translational modifiations by ubiquitin and ubiquitin-like proteins. J Proteome Res. 2014; 13(5):2478-2494
